Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_85G1-3
Clone ID CMHD-GT_85G1-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_85G1-3
Sequence
GTGACAGACCATGCCACCACTGCCCTGCTTCACTATCAGTTACCCCAGATGCCAGACGTCGTGGTCAGGTCCTTCATGAC
CTGGCTGAGAAGCTACATTAAGCTGTTCCAGGCCCCGTGCCAGCGCTGTGGGAAGTTTCTACAAGATGGCCTTCCCCCGA
CGTGGAGAGACTTCCGAACCCTGGAAGCTTTCCATGACACCTGCCGACAGTGACAGTGACCCCGGCCCCAGCACAGGGCA
GCCTGCAGACAGTCTTCNNCCAAACAGCCCGACCCATTCACCACACAGGAGTCTACCACTGTTCTCCCTGGCAGAACTGT
CAGCTGCATGTCATGATGGGGCATCACGGGAGGATGGTCTGCCCCTTCCCTGTGTGCTGGCCCCTGGTCTGCTGCTCCCA
TGAGCTGTTAATGGAATGAACCTCTTCATTCTTACATTGGTTATGCC
Sequence Type mRNA
Unitrap ID UNI14191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29378294..29380257 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es