Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14487E3
Clone ID IST14487E3
Vector VICTR74
Project tigm

Sequence tag IST14487E3BBF1
Sequence
AATTCTTTTGGTGTAATTAAATCTTAATTAAAATGCATAATAAGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGA
CTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 93711..182381 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]


Sequence tag IST14487E3HMF2
Sequence
AATTCTTTTGGTGTAATTAAATCTTAATTAAAATGCATAATAAGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGA
CTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCC
TCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATANNTAAATCTTTANAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14487E3HMR1
Sequence
AATTTAGACTGANCNTTCAGAGTCTGCCGTTTAAAAGCATAANGAAAAAGTAGGAGAAAAACGTGAGGCTGTCTGTGGAT
GGTCNAGGCTGCTTTANGGANCCTCCTCACCATTCTGCACTTGCAAACCGGGCCACTAAAACCCGGTGAAGGGAGAAACC
NAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000079834


For any suggestions or comments, please send an email to unitrap@crg.es