Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10593G6
Clone ID IST10593G6
Vector VICTR76
Project tigm

Sequence tag IST10593G6HMF1
Sequence
CCAGCAACNACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTAAAAAAATGCATAATAAATGAAAAATAT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10593G6BBF1
Sequence
CNNCAACCNCATGGTGGCTCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI5101 UNI30631 UNI30632 UNI31085 UNI33810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4238445..4238484 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10021492..10021531 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047879 (Usp14) NM_021522 ubiquitin specific peptidase 14 Gene [Source:MGI (curated);Acc:Usp14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26402066..26402105 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13776913..13776952 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 33934433..33934472 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23708004..23708043 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047246 (RP23-283N14.16) NM_178194 Histone H2B type 1-C/E/G [Source:UniProtKB/Swiss-Prot;Acc:Q6ZWY9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 36796287..36796326 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40542845..40542884 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020330 (Hmmr) NM_013552 hyaluronan mediated motility receptor (RHAMM) Gene [Source:MGI (curated);Acc:Hmmr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9513603..9513642 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 13516049..13516088 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054423 (Cadps) NM_001042617 Ca2+-dependent secretion activator Gene [Source:MGI Symbol;Acc:MGI:1350922]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28452407..28452446 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13376772..13376811 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38323753..38323792 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3207954..3207993 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7084645..7084684 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 28373837..28373876 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 44976089..44976128 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7336164..7336203 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5241456..5241495 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 12753077..12753116 38
NO GENE  

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es