Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14992G4
Clone ID IST14992G4
Vector VICTR78
Project tigm

Sequence tag IST14992G4BBF1
Sequence
ATATATAATTTGGAAAATTATATGACTCGATATAAACTTTGCTAAATCAAAAAAACACTACATAATTTATTTATTTGTGG
TGCCGGGGCTTGAACCCAGGGCCTCATCCATGCTATGTAAGTGTGGCACTACTGAGCACATCCCTAATACAACAGTTAAA
ACTTTCTATGTGCTCTTGTTTTGGTAATAGAGTCCCCCTGTGTTGCCCAGGCTAAACTTGAACTGGAGCCTTAGCTGGCC
TGAAACTCCTGATCTACCACATCCAGCTTATAAAACTTTTCAATGACATCAAATATGTTTAGAAAGGTAGGGTGGCGGGG
CTGGANANATGGTTTANTGGTTAANCNCTCTGGCTGCNCNNGCANANGNCNNGNNTTCNNTGNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14992G4HMR1
Sequence
ATATAACACTCTTAGAAATGAGAGGGCACATCCTCATCTTTAATTGAGCCNGATGTCTAGTTATTGTCTATGTGCAAATA
TCTCTAAGTTCATTAAAAATCTTAGTGAACTCGAGTCTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91723274..91723396 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es