Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_76F12-3
Clone ID CMHD-GT_76F12-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_76F12-3
Sequence
ATCCCCTTGATTACCGCCATTGAAATCGTCTCCATCTGGATTCTTTCCTTCTCTTGGCTCCCGGAAGCAATCGGCTTCGT
CATGGTACCCTTCGAATACAAGGGCGAGCTGCATAGGACCTGCATGCTCAACGCCACGTCCAAGTTCATGGAGTTTTACC
AAGATGTGAAGGACTGGTGGCTCTTTGGGTTCTACTTCTGCATGCCCTTGGGGTGCACAGCAATCTTCTACACCCTCATG
ACCTGTGAGATGCTCAACAGGAGGAACGGCAGCTTGCGGATCGCCCTTAGTGAGCACCTCAAACAGGTAAACACAATTCA
CAGGAAGGTGGCTGAGGCT
Sequence Type mRNA
Unitrap ID UNI14197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 80195384..80198967 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031616 (Ednra) NM_010332 endothelin receptor type A Gene [Source:MGI (curated);Acc:Ednra-001]

 
Come back to gene ENSMUSG00000031616


For any suggestions or comments, please send an email to unitrap@crg.es