Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0417
Clone ID AD0417
Vector pGT0lxr
Project sanger

Sequence tag AD0417
Sequence
GACGTGCTCCTTAAACTCTTCCTCTCCTTCAGTGGCTCGGATGTTCAGCACAAGCTCAAGGAGGCGGCCCAGTGCGTGGG
AGATGAGTTCATGAACTGTAAGCTGGCTGCTAGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAATTTGCCATGA
GCCGGGAGCTGATTCGAAATGTCTACAACAGCTTCTACAAGCTTCGAGACAGAGCCGAGCGGATTGCGTCCCGGGCCATT
GACAACGCTGCTGATCTTCTCATATTTGGAAAGGAGCTTAGTGCTTTGGGCTCCGACACCACCCCTCTGCCCTCCTGGGC
TGCTCTGCACCTCAGCACATGGGGCTCCCTGAAGCAAGCGCTCAAGGGCCTCTCCGTGGAGTTTGCACTGCTGGCGGACA
GAGCTGCACAGCAG
Sequence Type mRNA
Unitrap ID UNI2364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140828087..140831952 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es