Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14224C1
Clone ID IST14224C1
Vector VICTR74
Project tigm

Sequence tag IST14224C1HMF1
Sequence
CCCACAGGCCCAATGTATGTAGGTTCAGTTATGCCACTGACCTTAGCCAAGAACCAGACCACAGAGTTGCTACATCAGGG
GCGGGCCTTATTACTAGGTTGGGGGTTCCATGCCCTTAGGATTGTGGAGCAAGGAAAATTCTTTGCCCTCAGGAGACCAT
GTCCTCTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79870402..79870572 171
NO GENE  


Sequence tag IST14224C1HMR1
Sequence
GCTTACAACNNGAAATGCCTTAAAGTCTAAAGTAGACAGAAATCTTTTTTTCTGTTATTTTTANTTGGAGCTGTGTTGAA
CAGGCAAGTTTGTTTTTGTCTCTACTTTGGTGGTTGTTCACTTATTTCCTCCCTGAGTAGCTAGGATTATCTCCCGGTGT
GCCTCTTCACTTGACACAGAAATTTTATATTACAAACTCATCAGCCTAAGAAGTTATGTTGCTGAGCTTCGGGTGCCATT
CAGCAGTGGAGCACTTGCCTGTTCTGAGCTCANTGTANTATGGAGCANGGAATTCCATGGANAGTAAATGTTTTGGGAAG
ATAATTGTTTTGATTCATGGCAAGTCAAGANAGTGTTTGGAAAAGGATTAANAAGGTCCTGACTCNATGAAAGTCNGTGT
GGGGAAATCTCANTTGGTAACGCCN
Sequence Type genomic DNA
Unitrap ID UNI10410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121333087..121333511 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es