Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13693F5
Clone ID IST13693F5
Vector VICTR74
Project tigm

Sequence tag IST13693F5BBF1
Sequence
CTATAAAGCCCGCCCTCTCACTGGCTGGAAGCTGACCAGCGCTCTCACAGGAAAGCAGGGTCTGCCAGTCTTTTGATGCC
CCTGTACCAGGGCTGTGCCCCCTCCTTCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI34322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44058570..44058688 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032105 (Pdzd3) NM_133226 PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2429554]

 
Come back to gene ENSMUSG00000032105


For any suggestions or comments, please send an email to unitrap@crg.es