Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14317F10
Clone ID IST14317F10
Vector VICTR74
Project tigm

Sequence tag IST14317F10HMR1
Sequence
GATCCTCTTTGCATCGGCTACCACTTCTGCTTCCCATCTCCAATCCTAATCAGATCACCTCAGTTATGGACCCTTCCTCT
TCCTGGTAACCCGGTTGTATAAGCTATATGTCCAGGCTCAAAGCTTAAAAACCATCTACATTTTTAGCCCCTCCCCCAAA
ACAGAGATGAGCCAATTATGGGATTCTAAGCCCAACATCCACTCGCCCTANACATTCCTGTACACTCAGCCTTGACAATT
CAAAGTGTCTTTCTCATTTACTAATTNAANAACAANATATAAAGATATTTAANACNCANCCTTCTTACAGTCCCACAGTA
TTGGGGAATACAGGCTTTTAAACAAAAAATTCACTTGACANAAAAAGTTGTATGANGTAAAGCCCAAGAAAGCNTANCTG
CTGTNTGTTC
Sequence Type genomic DNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59596416..59596824 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]


Sequence tag IST14317F10BBF1
Sequence
ATCCGAAAGCTTACGGCCGCCTTGGCTACCAAGCAATTCAGTGAGTCCCTATTGCAAAAACCCAAAGCAAGAGCAAAAAC
TGAGAGAAGCTGGGGATAGGGCTCAGTTGAGGAGCACGGCCTAGCACTAGCTGCAAACTTCCCGCCTACATGCCCTCCCC
GCCTCCCACGCACACGGAACCGTCCTGACTGGAAAGGCAGGAGTGGCTTCCCTTCTCTCAGTTCCCAGAGCAGTCATTTA
ATTCTTTCAGTCTTCTGCTAAAGCTTCTCATCTTATCTTCAATTCTTTCTCGTCAAAGGATTCCTGCTTTTAAGGTTTGG
AAATCAACTCCCTCAGCTTCTTGTCTATTCNCACCACTCATCGCTCCTGTGTAGCTTGCTGGACTCTACCCTTANCATTA
NTCNTCTAGTGAGCTNTANTTTGTTGNAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59596822..59597250 415
 
EST/CDNA Est Name
  BB616156.1 - BU696064.1 - BU699435.1 - BB660535.1 - AI099305.1 - CJ182832.1 - CJ183377.1 - BB845658.1 - BY025518.1


Sequence tag IST14317F10HMF2
Sequence
GAATAAAAATTCACACACAGGTTCTTGAGACTGTAAATTCTTTAAAATGGTTTATTTATGTATTCATTAATTTTATGTGT
ATGGGTGTTGCCTCAATTGTTTTTCTATTGCTATAACAAGACACCATGGTCAAAGCAATTTATGAAAGAAACTATTTAGC
TTGGGAGCTCCAGAAGGTTAACGTCCATGGTCATCATGGCAGAGAGCAAGGCGGCAGGTAGGCAGGCATGGTGTTGGAGC
ANCAGCTAAGAGCTTAAATTCTGATCCAAAAGTTGGAGGCAGAAAGAGCTAACTGGCAATGATGTAGGTTTTTGAAACTT
CAAAGCCCATCACAGTGACAAACCTCTTCCAAAACAAGGCCATATCTCCAAACCAAACAGTTTCACCNACTTATAGAGGC
NACCTCCAGTANGGAGACAGGGAAGTGAGGGAGGGGGTTGCCATCCCACAGTCACNACTCNGNNCTGACCAAGCCGGCCC
AGTCNGTCNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22293105..22293595 471
 
EST/CDNA Est Name
  CO797064.1

 
Come back to gene CO797064.1


For any suggestions or comments, please send an email to unitrap@crg.es