Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14140A7
Clone ID IST14140A7
Vector VICTR74
Project tigm

Sequence tag IST14140A7HMR1
Sequence
GTTAATAGTTNAGTAGTTCTCCGAACTTCATTCCCAGCTTCTACCAAAACTCCCCTACTTCTAAGTTGANATTTTGTGGG
ANAGAAAAAGTGAAAGAGACCTTGTGTACTTGATAAAGTATTTGGCATAGTGCCTTTTTATGTGTGTGGTGCGATACAAT
GAATATTTGGAAGCTTGGGGGAGGGTTAAGTCAAATACTTGGTCTGTGCTATCGCCTTCTTGATCCCGAGAGAAGGTGTA
ACACTTAANTCAAATATGTGTCTTTTTTGGTACTAAAAATTTCAAAGGTTNAANNNTTC
Sequence Type genomic DNA
Unitrap ID UNI10857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072483..36072775 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es