Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14153B6
Clone ID IST14153B6
Vector VICTR74
Project tigm

Sequence tag IST14153B6HMF1
Sequence
TTCTAAGCGTACTCCATCTTTCCCACCCTAGACAGTGGCACTCTTAACTGCTGCAGTTGCTCTGTCCAAAATTTGGGAAG
TTTTCCTTAATTATTCCACTGATTGAAAACAAATTCAACCTATTAGTTAGTAAGCTCTCTTCACTCCACTTTGGAAGTGC
AGGTACAACCTGAATGCTTCCGACTGTTCCGACTCCCACCAATAAGGTCTGAGCAGGAAGCGCTCTTGCAGTAGCCTGGG
CGTGTCATTCTGCTTTTCTTCTCTCCTCTCCACAACACATTGGCTGTAGAGGCTTTCTCTGACGCCATCACAAGAAAGGC
TTCGCTGGTGGAAGTCAAGGGAGGGGAGTACCGGTACATGCGCGTGTATGCACGTGAGTGTGGAGTACAGAGGCTGACCT
TAATTACTGTGCCTCGGAAGCTTTGAACCTTGTCTGTANAGAGACGGTCTGTCACTGGAACCCGGANCTCGACAATTCAN
CTAGAATGGCCAGCCACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84793648..84794144 489
NO GENE  


Sequence tag IST14153B6HMR1
Sequence
NAAGANAATATTTAGATACAGGGTTGGGAATGTCTAAAGTCTTCAAGTGCCGAGGTTGAATAGACACTTGTATCTGAGCC
CAGAGTTCAGCAAAGATGTCTAGACGGGAGATAAATATTTATGGCACATGTTGGTGCTTACAAGGTTAGAATTGCTGGAT
CACATCATTATGAAAAGAAAAATGGATAGAGAAGAGGAGGTAAGCCCAAGATCAATGGGAAGAAAGATCNNAGAAGTCCC
GTTCTGGGTGCTAACAGCACCGACTGCTCTTCCAAAGGTCCTGAGTTCAAACCCCCGCAACCACATGGGATTTGAACCAC
CCATCATGANATCTGATGCCCTCTCCTGGTGCATCTGAAGTCNNCTACANTGTACTCATGTATATAATAAATAAATATTT
GGGCCTGANCAAGCCNAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84794143..84794561 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST14153B6BBF1
Sequence
TTCTAAGCGTACTCCATCTTTCCCACCCTAGACAGTGGCACTCTTAACTGCTGCAGTTGCTCTGTCCAAAATTTGGGAAG
TTTTCCTTAATTATTCCACTGATTGAAAACAAATTCAACCTATTAGTTAGTAAGCTCTCTTCACTCCACTTTGGAAGTGC
AGGTACAACCTGAATGCTTCCGACTGTTCCGACTCCCACCAATAAGGTCTGAGCAGGAAGCGCTCTTGCAGTAGCCTGGG
CGTGTCATTCTGCTTTTCTTCTCTCCTCTCCACAACACATTGGCTGTAGAGGCTTTCTCTGACGCCATCACAAGAAAGGC
TTCGCTGGTGGAAGTCNAGGGAGGGGAGTACCGGTACATGCGCGTGTATGCNCGTGAGTGTGGAGTACAGAGGCTGANCT
TAATTACTGTGCCTCGGAANCTTTGAACCTTGTCTGTNNAGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84793703..84794144 430
NO GENE  

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es