Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10282E2
Clone ID IST10282E2
Vector VICTR76
Project tigm

Sequence tag IST10282E2HMF1
Sequence
CCGGCAGATCCCCACACCAGGGTCACTGTCCAGGAGGGCTGTTGGAGTCTCCAGCTGCAGAATTTCAGATGTTCCTGGCA
TAGTGGGGTTATATTTTTCTTGTGTTGTGGGAAAACGTCTCAGTTTCAAGCTGCTCCAGACTAGGTCAGTCACTGTGACA
TGCCTCCTTCATTCTAGGCTATTCTAGGTCTCTGTTCCTCCATCTGTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI34329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135016821..135017032 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050150 (Nhedc1) NM_028946 Na+/H+ exchanger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921696]

 
Come back to gene ENSMUSG00000050150


For any suggestions or comments, please send an email to unitrap@crg.es