Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0392
Clone ID AD0392
Vector pGT0lxr
Project sanger

Sequence tag AD0392
Sequence
CAGCCCATGAGGTGGTAGTGGAGAAGGCCNTACTGAGCACACCCAATGGTGCCCNTGATGGCACCTCAACTGAGATATCC
TATGAGATCACCCCTCGTGTCCGAGTTTGGCGGCAGACACTTGAAAGGGTGCCGTAGTGCAGCCCAAGTGTGCTTGTGCA
TGGGCCAGCTAGAAAGGTCCATCGCGTGGGAGAAGTCTGTCAACAAAGTGACCTGCCTGGTCTGCCGGAAGGGCGATAAT
GATGAGTTTCTCCTGCTGTGTGATGGGTGTGACCGAGGCTGCCACATTTACTGTCATTGTCCCAAGATGGAGGCTGTTCC
AGAAGGAGATTGGTTCTGTGCTGTCTGTCTGTCCCAG
Sequence Type mRNA
Unitrap ID UNI2366

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127562163..127562701 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es