Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11942F6
Clone ID IST11942F6
Vector VICTR76
Project tigm

Sequence tag IST11942F6HMF1
Sequence
GTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAA
GTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI34232 UNI34330 UNI34331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13654697..13654822 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39165509..39165634 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22121999..22122124 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042302 (Ehbp1) NM_153078 EH domain binding protein 1 Gene [Source:MGI (curated);Acc:Ehbp1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94232871..94232996 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30506458..30506583 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 85460921..85461046 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024131 (Slc3a1) NM_009205 solute carrier family 3, member 1 Gene [Source:MGI Symbol;Acc:MGI:1195264]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 37319968..37320093 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20984968..20985093 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89912159..89912284 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57174786..57174911 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33541695..33541820 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 64967112..64967237 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3625498..3625623 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019734 (Tmc4) NM_181820 transmembrane channel-like gene family 4 Gene [Source:MGI (curated);Acc:Tmc4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 36795067..36795192 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 113413588..113413713 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53811028..53811153 126
NO GENE  


Sequence tag IST11942F6BBF2
Sequence
GTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATCTCTGTAANTCTGAGGCAGGCTTGTCTACAA
AGCAAGTTCCAGGACAGCCAAGGCCATTAACACANANAAACCCTGTTCANAAAACAAACCCCAAACCAAACCAAACAGGA
TTTCAAGAAAAAGAANGTGATCCTTTCNTTGTNNCNTTGTATTTGCTTTTTCCTTTATAAAACGTGCCGTCCCTCTGTCT
TTTGAGACAGGGGTCTCACTATGTAGCCCTGGCTGACCCANAGCTGGCAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3313413..3313709 277
NO GENE  

 
Come back to gene ENSMUSG00000019734


For any suggestions or comments, please send an email to unitrap@crg.es