Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12138B2
Clone ID IST12138B2
Vector VICTR76
Project tigm

Sequence tag IST12138B2HMF1
Sequence
GTCTCAAGCCTAGTGACCTGAGTTTGATCTCCAGAATCCCAGAACCCGCTCCTGCAAGATGACCTCTTTCTCCCACCTGA
GCACCCCAATCTTATACACAAGGAAAACAAAACAACAAAAATCTTTGATGGA
Sequence Type genomic DNA
Unitrap ID UNI33224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95486694..95486824 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST12138B2BBF1
Sequence
GTCTCAAGCCTAGTGACCTGAGTTTGATCTCCAGAATCCCAGAACCCGCTCCTGCAAGATGACCTCTTTCTCCCACCTGA
GCACCCCAATCTTATACACAAGGAAAACAAAACAACAAAAATCTTTGATGGCCAGCTGCCAAACTTTCCCTTTTTTAGGA
GGACGAAATGGAAGAAACAGTCAAATTCTTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI33224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95486610..95486824 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es