Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14040C1
Clone ID IST14040C1
Vector VICTR74
Project tigm

Sequence tag IST14040C1HMF1
Sequence
CCGCCTACTTTTGTCCCCTTTCCAGTTTCATTCTTTGTTGTAGACACTGCCCGAGGCAAAGATTGTTTTGTGTCCATAAA
TCCAGGCTATTTTGCCTGTGCTGCCTTTGGCAGCTCCCCCAAGGCTGCCTGGGGGCTCCCCACAGGGTCATTCTATACAG
CTCCTGGTTTGCATCTGCCCCTTCCTACTCTGTAGACTGGGTATCCAAGTATCACACATGGGTGAGGGTCTGGGGTCTGG
AAGCTAGATTGGAAGGGATTGTGAGAATAAGGAAAGTACCCTTAAGGGGCAGTCTGGGACTATCGGANGGGCCTGCGTGT
AATTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI23753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30020592..30020921 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]


Sequence tag IST14040C1BBF1
Sequence
CCGCCTANTTTTGTCCCNTNTNNNGNNTNNTTCTTTGTTGTANACACTGCCCGAGGCAAAGATTGTTTTGTGTCCATAAA
TCCAGGCTATTTTGCCTGTGCTGCCTTTGGCAGCTCCCCCAAGGCTGCCTGGGGGCTCCCCACAGGGTCATTCTATACAG
CTCCTGGTTTGCATCTGCCCCTTCCTACTCTGTANACTGGGTATCCAAGTATCACACATGGGTGAGGGTCTGGGGTCTGG
AANCTAGATTGGAAGGGATTGTGAGAATAAGGAAAGTACCCTTAAGGGGCAGTCTGGGACTATCGGAGGGGCCTGCGTGT
AATTGGCCNGGTCTAGCTCTGANCTGCTGANGCCGGGTGGCAAAGCCTCATTTANAGCCCTGTATTNNCTCTGCTTTGCT
GGAACATGAANGGATGGGCGGGGGGCTCCATANGGAGGTGGAGGGANCTNATCNCANCNNCCAANGCCTGGCNAATGAAT
GATGCANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es