Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14476F9
Clone ID IST14476F9
Vector VICTR74
Project tigm

Sequence tag IST14476F9HMR1
Sequence
CATGCTTCTCCTCCNGCCTCCCCTACACCCCCAGCCTAGACTTCCCGTGGAACCCTTACATGTTATCTACTTAATCTTGC
GAGTAGCANTTTTTGGACAGTGGTGTTTCACTCTCACTCCAAGGGTATCTCCTGCATCANCTCTAGTTCTATAACTTCCA
GGGCTTGGGAATCTACCCTGCCCANGACTTAAAGTGTTATAAAAGAAGTTATTTTTACAATATANNGGC
Sequence Type genomic DNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21746093..21746316 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]


Sequence tag IST14476F9BBF1
Sequence
GCATGTATTTATGTTCCTCCCTTTACCGTCTTTTAGTGAATGCAGGGCTCTCTGGGCAGACATCAGTTCCATGATTACAT
ACTACTGTTTGCAAGTTTTAGCCTTTATCTACCCACAGCTTCGACAGTATACTTACGGATTTTACAGGCTGCCATTAGGG
AGGTGTTCTTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21745922..21746097 176
NO GENE  


Sequence tag IST14476F9HMF1
Sequence
GCATGTATTTATGTTCCTCCCTTTACCGTCTTTTAGTGAATGCAGGGCTCTCTGGGCAGACATCAGTTCCATGATTACAT
ACTACTGTTTGCAAGTTTTAGCCTTTATCTACCCACAGCTTCGACAGTATACTTACGGATTTTACAGGCTGCCATTAGGG
AGGTGTTCTTANATCTAAACTCTAAGCTCANTACTCCCATGCCTAAGACTTCCTTCCNATCCNAATGACTANNTGCATTG
TACTCNTNNCANGACTCANCNATNNGTTGCTTTACTCNACTGANNTTTCTTTNNTGTTNNCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es