Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_87C12-3
Clone ID CMHD-GT_87C12-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_87C12-3
Sequence
GGATTCCTGGAGATACTGTATACTTTTGGCAAAGCCTCTGAGAAAGAGCATCATCCCCTCCCATGAACAAACTCTGGGCT
GATGTCACCGCGTGAGGATGAGAGGCAGCAGGCACATCGCAGTGCCCAATCTCACGCTTACGTTCACAGATCTGCAACGC
AGGCCTTTGGTCCAAGCGGGAAGGCTCCAGCAGACTCGGGCCTGGGGCTGAGGAACACTGCCTTTTTCTCTTTGTGCCAC
CATG
Sequence Type mRNA
Unitrap ID UNI14207

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119524008..119524251 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034813 (Grip1) NM_130891 glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

 
Come back to gene ENSMUSG00000034813


For any suggestions or comments, please send an email to unitrap@crg.es