Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12362F4
Clone ID IST12362F4
Vector VICTR76
Project tigm

Sequence tag IST12362F4BBF1
Sequence
AAGCCAGCCTGGTCTACAGAGTAAGTTCCAGGACAG
Sequence Type genomic DNA
Unitrap ID UNI30820 UNI31009 UNI32411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 130357..130392 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079808 (AC168977.6)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 144897..144932 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079193 (AC133103.5-208)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80513568..80513603 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33132174..33132209 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54420208..54420243 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12978197..12978232 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 93733491..93733526 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32211397..32211432 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52374311..52374346 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 41070217..41070252 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35230653..35230688 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71463055..71463090 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74580595..74580630 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]


Sequence tag IST12362F4HMF1
Sequence
AAGCCAGCCTGGTCTACAGAGTAAGTTCCAGGACAG
Sequence Type genomic DNA
Unitrap ID UNI30820 UNI31009 UNI32411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74580595..74580630 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32211397..32211432 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12978197..12978232 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54420208..54420243 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33132174..33132209 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80513568..80513603 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35230653..35230688 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 41070217..41070252 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52374311..52374346 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 93733491..93733526 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 144897..144932 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079193 (AC133103.5-208)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 130357..130392 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079808 (AC168977.6)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71463055..71463090 36
NO GENE  

 
Come back to gene ENSMUSG00000079808


For any suggestions or comments, please send an email to unitrap@crg.es