Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_84B9-3
Clone ID CMHD-GT_84B9-3
Vector pSD5
Project cmhd

Sequence tag CMHD-GT_84B9-3
Sequence
TACAGTTGGGAAGAACATACAATTGAAGACCATTTCCAAACTTCTAGAAGTCATGGAAGGTAATTTTCTTCTGCAAGCTG
ATGAGAAAATGCCTATGAAGAAAGTTTAACGTGTGCTACAAGTAATAAAGAAAACCAATAGGGTACAGT
Sequence Type mRNA
Unitrap ID UNI14212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175109133..175109279 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078901 (RP23-166A1.1) NP_001028295 ethanol induced 1 [Source:RefSeq peptide;Acc:NP_001028295]

 
Come back to gene ENSMUSG00000078901


For any suggestions or comments, please send an email to unitrap@crg.es