Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14423A1
Clone ID IST14423A1
Vector VICTR74
Project tigm

Sequence tag IST14423A1HMF1
Sequence
CCACCATGGAGAAAAGACCCCTGGCAGGGTGCCTGAGCTAGAGAGTCAAGCACTGGCTCTCAGTCACAGTGCCAACCAAG
CAGTAGCCTTTGGCACCTGCTCCTGTCTCATGTCCTCCCACCAGAGGGAGCCTAGGAGGAGCCTCTGATCTGTCATCTGG
TTCTGAGGACCTCCAGGGAACAGCACAGCATTCACCTAGGGTCCATCTCCCTGGGTGAGGAGGCCAGCACCCAGAGCAGG
AAAGGAGACGCCAATGACTGCCCCACCCCCACCATCAGCAGATCCAGTCTCCAGGGATACCCTTTCACTTCCTGTCCCTT
GGTTCTGTCCAGGGAGGTAGGGATCATTCTTGGAAGCCNGGATCCAGCCCANGCTCTGCACTCCTCCTAANAAAGGAGGA
AGGAGATGTCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4606509..4606918 404
NO GENE  


Sequence tag IST14423A1HMR1
Sequence
GGACCNNGCCACCAGCCCTTCCTGGCTCCTGAATTCTTAATCAGCATAAATATTTACTTCCTTCCTCCCCNTCCAGGCTC
CCAGCATAC
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4606960..4607047 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]


Sequence tag IST14423A1BBF1
Sequence
CCACCATGGAGAAAAGACCCCTGGCAGGGTGCCTGAGCTAGAGAGTCAAGCACTGGCTCTCAGTCACAGTGCCAACCAAG
CAGTAGCCTTTGGCACCTGCTCCTGTCTCATGTCCTCCCACCAGAGGGAGCCTAGGAGGAGCCTCTGATCTGTCATCTGG
TTCTGAGGACCTCCAGGGAACAGCACAGCATTCACCTAGGGTCCATCTCCCTGGGTGAGGAGGCCAGCACCCAGAGCAGG
AAAGGAGACGCCAATGACTGCCCCACCCCCACCATCAGCAGATCCAGTCTCCAGGGATACCCTTTCACTTCCTGTCCCTT
GGTTCTGTCCAGGGAGGTAGGGATCATTCTTGGAANCCANGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4606555..4606918 360
NO GENE  

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es