Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14863H5
Clone ID IST14863H5
Vector VICTR76
Project tigm

Sequence tag IST14863H5HMR1
Sequence
NNNTGTCTTCCCTTGTCCTTTGTGTCTCAACCCTCGTGTGAGTCGTTAGTCACGCTCATTTTACTGCGGTCTCCCAGTTG
GCTCCTGCCTGTCGAAGTGTGTGTTACAAAGTCTGGTTAGCGGTGGAGCCCACTCTGTCTCTCCCGTCTGGTGTTCCCGT
TTCTTATGTNATGAGTCTCTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379747..35379928 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es