Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11278H8
Clone ID IST11278H8
Vector VICTR76
Project tigm

Sequence tag IST11278H8HMF1
Sequence
CCAGGGCTACACAGANAAACCCTGTCTCGAAAAACAAAAACAAAAACAAAT
Sequence Type genomic DNA
Unitrap ID UNI34339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94603449..94603499 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042082 (Arsb) NM_009712 arylsulfatase B Gene [Source:MGI Symbol;Acc:MGI:88075]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84562052..84562102 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108142062..108142112 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 85193446..85193496 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 143243185..143243235 49
NO GENE  

 
Come back to gene ENSMUSG00000042082


For any suggestions or comments, please send an email to unitrap@crg.es