Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418C10
Clone ID IST14418C10
Vector VICTR74
Project tigm

Sequence tag IST14418C10HMF1
Sequence
TATGTAGGAATAAAGGCAAGCTTAATGTTGTTCCTTAACCTTCTCTATATTGTTTAATGTTCACAATGTATGAATTTATC
TCAACTGTATGTAAAGATGGGTATTTCAAGACCTTTAAGGAATCTCCTGGCTTAGCGCTTAGCACCAACAGAAGAGAAAC
TCAGAAAGAACATTCTTAAAGATGAGATCAGTGTACAAAGGCCGTCCACAGGCAGCTGTGGCGCACTTAGCTTCAAGAGG
AGGGCAAACCTGACACAATAAATTCCAAAAGTGCATTTCATCACAAGTAAGGTAAGCAGGCTTGCTTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 112074853..112075162 310
 
EST/CDNA Est Name
  CJ168128.1 - CX237746.1 - BY320854.1 - BY189011.1 - BU583093.1 - BY099536.1 - CX214276.1


Sequence tag IST14418C10HMR1
Sequence
AAGGAACTGTCACATACACCCATAAAAAGCAGCACAAAAGACCTANNAGTGTCTGAGCTGATAACCCGTCGGGTGGANAG
CGTCTAANTTCACTTCCTGT
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104154687..104154786 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es