Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14673A3
Clone ID IST14673A3
Vector VICTR74
Project tigm

Sequence tag IST14673A3HMR1
Sequence
TCCTTACATGCGTACAAACCAAGGGTAGGGTTGTTGTACGTTAGATATAGTGTTTTGAAAGGTGGAAGGTANTAGCTCTG
TTTTTTCTTATTTGATTAGCTGGCTTACTTCGTGAACAGTTGCTATGTGTTCATAAATGATCAAATAATAAATGAAGTAC
ATTAAGCATTCATAAAATTCATTTCACAGACTCACGTTTCTATGTAGGTATTGGGTTATGCACTATGTTAATCTGTTTGT
TCCTCACTTTTANAAACTTTATTTTTGTCTACTGTGAGAATTCATATTGACATACATAAGTCTGACTGTTACCGGGAAAT
GGTTTTTGTTTTTAATAGTTTTGAGGAGCACNAAACAGCCNTTTGGAGAANATGGAANATTCCTTTAANANNANNATCTA
AATTTGANNGGAAAAATNCTATGGTATGAAAGCTCCTTAAATTTCTATTAANTTGNNAAAATTTTAAGAN
Sequence Type genomic DNA
Unitrap ID UNI24121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59640331..59640799 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045071 (E130308A19Rik) NM_153158 RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]

 
Come back to gene ENSMUSG00000045071


For any suggestions or comments, please send an email to unitrap@crg.es