Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_23A3-3
Clone ID CMHD-GT_23A3-3
Vector pMS1
Project cmhd

Sequence tag CMHD-GT_23A3-3
Sequence
GAGTGCAGATGAAGAAGAGCAGCTTCGCACCCTGCTAATGTGTGTGGCCACGGGAAACGCTGCAGAACAACATATGTATA
AATA
Sequence Type mRNA
Unitrap ID UNI14219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 170704815..170704898 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027560 (Dok5) NM_029761 docking protein 5 Gene [Source:MGI (curated);Acc:Dok5-001]

 
Come back to gene ENSMUSG00000027560


For any suggestions or comments, please send an email to unitrap@crg.es