Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14827A1
Clone ID IST14827A1
Vector VICTR76
Project tigm

Sequence tag IST14827A1HMR1
Sequence
AGCTCACATGGAAGCCTANAATTATGTTATTGTTTCCCTTGANAGCTCAGATTTTGGAAGCATGGACCGTCATTATTATC
TGATAATCATGAGCTGGGACAATAATTT
Sequence Type genomic DNA
Unitrap ID UNI34341

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108004267..108004374 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039199 (Zdhhc1) NM_175160 zinc finger, DHHC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918046]

 
Come back to gene ENSMUSG00000039199


For any suggestions or comments, please send an email to unitrap@crg.es