Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0334
Clone ID AD0334
Vector pGT0lxr
Project sanger

Sequence tag AD0334
Sequence
ACTCCTCCATATCCCTTTGGATCTTCTTTGTCTTCAGGTCCAGCGGAGACGGGAACAAGATGGCGATCCCGGGCAGGCAG
TATGGGCTTATTTTGCCAAAGAAAACACAGCCGTTGCACCGAGTTTTACAGAAACCGTCAGTGTTTGGGAGTGATTCTGA
TGACGATGAG
Sequence Type mRNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76890156..76891925 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es