Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10979F7
Clone ID IST10979F7
Vector VICTR76
Project tigm

Sequence tag IST10979F7BBF1
Sequence
CCCACAATGGGCCACCTCTAGCCTCTGGCCTTACAACCCATCCCCAAATGAGGCCAGCCAGGACAGCTGTCANCGGTCAG
CTGCAAAAAGGAGAGCTGGCANCCAGGCTTCCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNTNT
N
Sequence Type genomic DNA
Unitrap ID UNI21804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58143549..58143704 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]


Sequence tag IST10979F7HMR1
Sequence
GTGGGGATTAGTTCTCTCCGAGAATATGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es