Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10453E10
Clone ID IST10453E10
Vector VICTR76
Project tigm

Sequence tag IST10453E10HMR1
Sequence
AGTTAGTTGTAAAGATCGACAGCGGTCATCCTTCAGAAATACTTGATTAGATTCCTTTTACCTTTCTATTCCCTATTGTC
AAAATGGCATGATGCACAGAACTTCAATTCTTGGTTACAAAAGGAGCTTCTGACATGCAGAAGTTTCCCAGGTGTTGCTG
GTGCTGGGTGGGTGGATAGGACAGATTGGAGCATAATGCATATGGCAGGAANCANACNTTAAATTATCATTCAT
Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177357401..177357633 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]


Sequence tag IST10453E10BBF1
Sequence
ACTTCTAAACTATTTTATAAAATTAGTCACACAAAACTGAATACAGAAGGGTCAGGAATTCTAGAAAGCAAACCGTTACT
TTTCCAATGTTGTCCTACGGCACACTAAAGGCCATGCCTGTATATAGGCCCTGCATAGTGACATTTAAATTCCATACCTT
CCCACTCCCAGGCCTAGCGAGCCACCCCCACCCCTGTAAATCCACACTCAGGAAGAGTCAAAGGACAAGGGCCTCTGTTA
TGATCACCACATGGACNNACANAACCACACTCTGACCCACAGTCNATTTANAACCAGCANATCAGACTCAAATANCTCTG
CANACTTGCTCCTNCTGTANTCTCAATGGACATTACTATAATAACCAGGGGATGGCTTGTGGTCTTCCAGGCAGCTTGTA
ACACATGCATCTGANGANAATCCTTTAAAGAACCANCAAGCTACCTAACTTCTCCTAGTGTTCCTGATGGTTAGGCCTGC
CCANANTCCCTCATTAGCATGGAAAACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177357631..177358139 479
 
EST/CDNA Est Name
  CJ050500.1 - BM125820.1 - CN690235.1

 
Come back to gene CJ050500.1 - BM125820.1 - CN690235.1


For any suggestions or comments, please send an email to unitrap@crg.es