Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13824H6
Clone ID IST13824H6
Vector VICTR74
Project tigm

Sequence tag IST13824H6HMF1
Sequence
AAGAGAGAATCAAAGGGCGGCCTGGGGTACATAATATTCTGCCTCAAAAATACACATAAAATAAAACCAGGGGCTGGANA
GGTGGCTTCGCAATTAAAAGCGCTGGCTGCTCTTATGAGGACCTGTTTGCCTCTTGGCAGCCGCACCAGGAGCCTCCCCA
GGCACACTCTTGATTAAAAATAAATCTTAAAAAACACCGACAGACACAGTTGTCCAACAGCACGGTGTGTGCAGTCTTGC
TGANCTCGGCTTGCCCATTTTTTCAATTATAGCTTTCATCTCAATCCAGTCATTATATATGTTTTTCATTTTTCTTCTGT
TTTGTTTTTTTGTTTTCTGANACAGGGACTTTCCTGTGTACTGTAAGCCNCCCACAGCCTGANTCNNCTCNTCANCNCTG
GGGTCNCAGANGCCCACTGCCATGCNTGNCCNNCC
Sequence Type genomic DNA
Unitrap ID UNI12540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21592570..21593000 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es