Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14203A9
Clone ID IST14203A9
Vector VICTR74
Project tigm

Sequence tag IST14203A9HMF1
Sequence
AGGNCAGCCNGGGCTACACAGANAAACCCTGTCTTGAAAAAAANCAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14203A9BBF1
Sequence
AGGACAGCCNGGGCTACACAGAGAAACCCTGTCTTGA
Sequence Type genomic DNA
Unitrap ID UNI31276 UNI31415 UNI34343 UNI34344 UNI34345 UNI34346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166283: 28505..28541 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166282: 25338..25374 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 77489..77525 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 163857..163893 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_162750: 26578..26614 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079222 (AC132444.3-206) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C308]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166326: 109131..109167 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 101818..101854 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 26660..26696 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070032 (AC133103.5-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 200302..200338 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079831 (AC170088.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 297796..297832 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 1907487..1907523 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4160633..4160669 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3388181..3388217 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3226815..3226851 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3842532..3842568 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6372066..6372102 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022150 (Dab2) NM_023118 disabled homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109175]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3613513..3613549 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3518205..3518241 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3214746..3214782 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3237130..3237166 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8584831..8584867 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3155064..3155100 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3182458..3182494 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4614931..4614967 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3217184..3217220 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5415784..5415820 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3760694..3760730 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9036031..9036067 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5518511..5518547 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4305140..4305176 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026657 (Frmd4a) NM_172475 FERM domain containing 4A Gene [Source:MGI (curated);Acc:Frmd4a-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4153359..4153395 35
NO GENE  


Sequence tag IST14203A9HMR1
Sequence
CCTGGAACTCACTCTGTANACNAGGCTGGCCTCNAACTCANAAATTCACCTGCCTCTGCCACCCANCCGTATGGGTGTTT
TTTCTGTATGTTANTGCACAGTGTGCATGCCTGCTGTCTGTGGAGGCCAGAANAGGAAGTTGGACATGGTAGGGTTGGAG
TTACAGACATCATGAGCTGCCGTGTACTGATGGGAACTGAACCTGGGTCCTCTGCANGGGCAGCACTGAGCCATCTCTCT
AGCCAGTTAAGCACANTTTCACCAAGGTGTAAATTCTCCCCCTANNNNNTNNNACCNCACACAANACCAACCNNAAAGCN
TCTTCTCANGTTTCNAGCTTGCCAAAAATGTCNCAAATATGGNCAAACAAATCTTTCNCTNANATACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026657


For any suggestions or comments, please send an email to unitrap@crg.es