Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11002G10
Clone ID IST11002G10
Vector VICTR76
Project tigm

Sequence tag IST11002G10HMF1
Sequence
CTATCATATTACGAAGTTTGGATGTCAATTAATACCTATGAATACCTATTAAAGCAAGCTTTAATGCTTTAATAAAGAGA
CATTGCTTTAAATCTTATTTTAAATTTTACTATTTAGGATACGAACCACATTAATTATTACCTAAACTAGAAATATCTTT
AGAGACCCAGCCTNTTGGGCTGCCTTATGCCATGTGTCGGAAGGACTCTAAACTTGAGTTATCAAATTTAACACTAACCN
TNTGTAGCAATGTAACAATTATTAATCTTAACCNACAACTTATGAGCTGATTGTGAAAACNNTCANAGCACATTATCAAT
AAAAAAGAACCNAATGAAGCANTTACNTTTAGACCNATCNGAGAATAATAATTTTNGTANCTACAACCATAAAAATAAAA
AACACTTTACCATTGTCAAACACNTN
Sequence Type genomic DNA
Unitrap ID UNI30626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81748769..81749191 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15072049..15072471 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29593839..29594261 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222841..5223263 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 133963354..133963776 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77221590..77222012 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7564005..7564427 395
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7467635..7468057 395
NO GENE  

 
Come back to gene ENSMUSG00000028399


For any suggestions or comments, please send an email to unitrap@crg.es