Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11201A11
Clone ID IST11201A11
Vector VICTR76
Project tigm

Sequence tag IST11201A11HMF2
Sequence
ACACTAAGTCCAGTGATGACTTCGGGGATCTTGAATCCCTATGTAAGTAACTGTCTCAGTTACTTACTGCACTGGGTGAA
GACTTGAGCATACACAGGAAGCCTCAAATCAACCTACACCATGACACACTTCCTCCAACAAGGCCATACCACCCAATAGT
GCCACTCAATAAAACATGAATCTATGGGGCCAAACCTATTCAAACCACTAAATTCCACTCCCTGGCCCGTATAGGCTTAT
AGCCATAACACAATGCAAAATGCATTTANTCCAACTTCACAAGTCTGTCTATTGAANTGACAACAATGTTTAAAAGTTCA
AAGTTCANAATCTCTTCTGAGATTCATGCNATCTCTTTACTGCAGTTCCCTATAAAATCAAAAAGCAGACAGCATATTTC
AAAAGAATGGATATACATTACCATTTNAAAAATATCAAGANTTTGGAAATACTGGATCANAACNAGACCNAAAACCTGCT
GGGCAAACTCTCNACTCTGCATCTNNNNNTGCNTGTCCAATTNNNTTNANCTTNGTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11201A11BBF1
Sequence
CTGGGATTACAAGGCATTCATCAGCCATCCATCCATCCATCACAAAACTCTGTCTCGACACTGAACTCAGGGCACACAAG
AAAGACACAGCACACTAAACAAACTCTAGCTGCTTTGAAAATATTACTAATATGGTTTCCAAATAGGTCTTACANAAAAA
AAACATANATNTANATTATAATTGTTATAACTATACATTGTACATGTCACAATAAGAAAAGAGGGCTGGANAATTGGCTC
ANCGGTTAANAGCACTGACTGCTCTTCCAAAGGTCCTGAGCTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTG
CAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92926055..92926387 309
 
EST/CDNA Est Name
  CB522201.1 - BF016173.1 - BB854579.1 - CA882776.1 - BE656037.1 - BB848239.1 - BY253892.1 - BF022160.1 - BY322602.1 - BE554749.1 - BY095534.1 - BY133051.1 - BB857967.1


Sequence tag IST11201A11HMR1
Sequence
GTGTTTGCTTATTTATACAGGGTTAGACATATCCCAGGCTGGTCTTGAACTTTTCAAGCTATCTGTAGTTGAGGATGACC
CTGAACTTCTGATCTTCCTATTTCCACCTCCCCAGTAGTGGGATTACAGGTGTGTACCTGTTTTTCTTTTGTTTATTTTT
GTCTTGTGTTGGGGATGGAACCAAGGACCTTGTGTATGCTAGGCAAGCATTCAACCAACTGANCTACATCCCTTGTCTTG
TTGGTTTGAANATTATCTTTCTGATTTTCANTGATTCTGTTTACAGTTACTATACTCACAGGGTTTTGANTTTN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507865..108508177 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es