Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12835E8
Clone ID IST12835E8
Vector VICTR76
Project tigm

Sequence tag IST12835E8HMF1
Sequence
CTCTTAAAGGTCCCGGAAGCTACATAGCANCTCACGGCTACCTGTAACTCCAGCTTCAAAGGATCTAATGCCACTTCTAG
CCTTTTTAGGCACTGCACACACATGTGCANACTCACACAGACACATATACATTCTCTATAAAAATGTTTGCCTGGCAGCA
TGGTTTCTGATGGTACAAGGAGCAAACCTTGTCCCCTTTGCACACATCANCCTTANTTAATTAATTTAAAAGTAATTCTT
GGGCTGGTGANATGGCTCAGTGGGTAAGAGCACCTGACTGCTCTTTCGAAGGTCCNGANTTCAAATCCCANCAACNNCAT
GGTGGCTCACAACCNTCCGTAAGGAGATCTGACTCCCTCTTCTGGAGTGTCTGAANACNGCTACAATGTACTTACATATA
ATAAATAAATAAATCTTN
Sequence Type genomic DNA
Unitrap ID UNI17032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20190812..20191228 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]


Sequence tag IST12835E8BBF1
Sequence
CTCTTAAAGGTCCCGGAAGCTACATAGCAGCTCACGGCTACCTGTAACTCCAGCTTCAAAGGATCTAATGCCACTTCTAG
CCTTTTTAGGCACTGCACACACATGTGCAGACTCACACAGACACATATACATTCTCTATAAAAATGTTTGCCTGGCAGCA
TGGTTTCTGATGGTACAAGGAGCAAACCTTGTCCCCTTTGCACACATCANCCTTANTTAATTAATTTAAAAGTAATTCTT
GGGCTGGTGANATGGCTCANTGGGTAANANCACCTGACTGCTCTTTCNAAGGTCCNGANTTCAAATCCCANCAACCNCAT
GGTGGCTCACAACCNTCCGTAAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI17032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20190812..20191162 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es