Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S23-6B1
Clone ID FHCRC-GT-S23-6B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S23-6B1
Sequence
AGAAGCCCCAAGCCACCTCCGGACCTTCCGTCATGGAAGACTCCTCGCTGCCTGTGGTTCCTGCCCCCATCGCTGCTCCA
GGACCAGCACCATCTGCCACTGCGCCTCGGGTCCCCTTTCACTGTAGCGAATGTGGCAAGAGTTTCCGTTACCGATCAGA
CCTGAGGCGCCACTTTGCTCGACACACGGCTCTCAAGCCCCACGCATGTCCTCGATGCGGTAAGGGCTTCAAGCATAGCT
TCAACTTGGCTAACCACCTGCGCTCACACACTGGTGAACGACCCTACCGATGCTCTGCCTGCCCTAAGGGATTCCGAGAC
TCCACTGGCCTGCTGCACCACCAGGTGAGTCCGGGGAGCCACATGTGGCTCAGACACTGGGACTCCATTCCACTCAGGGA
AAGGCAGCTAGTGATGGCCCTGGCTAGTAAATTTGCCCCGCAGCCGTGTGTTTACACCATCTTGAAAATATGTTAGTGTA
CACCCAATAGGTCCATGTACACCCACCTCCTTTATTCTACAATGATCAATTTCCCCTACATGGAACACAGGCCTTCAAGG
GAACTCAACGAGGCCTACAAATGATCAGGCACCAGGTAGAGGTTAAAGAAAGCAGTTTCTGCCAGGCAGTGGTGGCACAC
GCCTTTAATCCCAGGCAGAGGCAGGCAGATTTCTGAGTTCAAGGCCAGCCTGGTTTACAGAGTGAGTTCCAAGACAGCCA
GGGCTATGCAGAGAAACCCCTGTCTCGGAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4963866..4964621 749
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es