Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S23-4B1
Clone ID FHCRC-GT-S23-4B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S23-4B1
Sequence
ACGCCACCGGGGTTGTGGATGGGGAGCGCGAGGCCACCATGAGGGTCCCCGAGAAGTACTCGACGCTCCCGGCGGAGGAC
CGCAGCGTCCACATCGTGAACATCTGCGCCATCGAGGACCTGGGCTACCTGCCGTCCGAGGGCACGTTGCTGAACTCTCT
GTCCGTGGACCCCGACGCCGAATGCAAGTATGGACTATACTTCAGGGATGGCAAACGGAAGGTGGACTACATCTTGGTAT
ACCATCACAAGAGAGCCTCAGGGAGCAGGACTCTGGCCAGGAGGGGACTACAAAATGACATGGTCCTGGGGACCCGCAGC
GTCAGGCAGGACCAGCCCCTTCCCGGGAAGGGGAGCCCTGTGGATGCAGGCTCACCGGAAGTCCCCATGGATTACCATGA
AGATGACAAACGCTTCAGACGGGAGGAATATGAGGGCAACCTGTTGGAGGCAGGCCTGGAGTTGGAGAATGACGAGGATA
CCAAAATCCATGGTGTCGGGTTTGTGAAGATCCATGCGCCCTGGCATGTGCTCTGTAGGGAAGCTGAGTTTTTGAAACTA
AAGATGCCCACAAAGAAGGTGTACCACATCAGTGAGACGCGAGGCCTCCTGAAAACCATCAACTCGGTTCTGCAGAAGAT
CACAGACCCCATCCAGCCCAAGGTGGCTGAGCACAGGCCACAGACCACAAAGAGGCTCTCCTATCCCTTCTCCCGGGA
Sequence Type genomic DNA
Unitrap ID UNI14239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 151841516..151864684 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031075 (Tmem16a) NM_178642 anoctamin 1, calcium activated chloride channel Gene [Source:MGI (curated);Acc:Tmem16a-001]

 
Come back to gene ENSMUSG00000031075


For any suggestions or comments, please send an email to unitrap@crg.es