Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S23-3B1
Clone ID FHCRC-GT-S23-3B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S23-3B1
Sequence
GATTTAGTCACCTATGATGACGTGCATGTCAACTTCACTCAGGAAGAATGGGCTTTGCTGGATCCTTCTCAGAAGAGTCT
CTACAAGGGTGTGATGCTAGAGACCTATAGGAATCTCACAGCTATAGGTAATATTGTGATTTTTTAATTTACTTTATAAC
ATGTATGTACAACTGTTTCTTTGTTATTCTCATTTGTTTTTGTAATTTCAATTGAGAATGAGGAATAATATGGTGAATAA
ATCACTCATGGTTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI4932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176868948..176869205 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es