Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10131G12
Clone ID IST10131G12
Vector VICTR76
Project tigm

Sequence tag IST10131G12BBF1
Sequence
ACACACATACACACGACACACACACAAGCACACACATACACAGAGACACACATATACCCACAGACAGACACACAGATTTA
TAGAAACACCTGGTCCCTGTAAGAACAATCTGAATCTAAACTTTGAGGTTATTGTTCTTTTCCTTTAGATTGAATATGGC
CTTCTTTCTGCCATTATGCTGCTAATGTAATGTACCTACAGACTTTAAGTTTTTATCTTACAAAGAGAGAGCCTTAAAGA
ATCATTATTCAGCCAGGTGGTGGTGGCACACACCTTTAATCCCCATGCTCAGGGAGGCAGTGGCAGGTGGATCTCTGTGA
GTTTGAGACCAGCATGATCTATAGTGTGAGTTTTGGGACAGGGAAGGTACACAAAGAAATCCTCTCTCAAAAAATAACAA
TAGGATATTCACAGGTGTGGGGTGATACAAACCTCCATTCCCAGCACTCAGAACGCTAAAGAAACTATCCTGAGCTACAT
AGTGAATCTGAGGCCACCCTGGGCTACAAAGTGAAACTTTGTCTCAAAAATAAACAAAAAATGACCCCAAACCC
Sequence Type genomic DNA
Unitrap ID UNI32803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127342700..127343252 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040127 (Sdro) NM_027301 retinol dehydrogenase 20 Gene [Source:MGI Symbol;Acc:MGI:1917311]


Sequence tag IST10131G12HMF1
Sequence
ACACACATACACACGACACACACACAAGCACACACATACACAGAGACACACATATACCCACAGACAGACACACAGATTTA
TAGAAACACCTGGTCCCTGTAAGAACAATCTGAATCTAAACTTTGAGGTTATTGTTCTTTTCCTTTANATTGAATATGGC
CTTCTTTCTGCCATTATGCTGCTAATGTAATGTACCTACAGACTTTAAGTTTTTATCTTACAAAGAGAGAGCCTTAAAGA
ATCATTATTCANCCAGGTGGTGGTGGCACACACCTTTAATCCCCATGCTCAGGGAGGCAGTGGCAGGTGGATCTCTGTGA
GTTTGAGACCNGCATGATCTATAGTGTGAGTTTTGGGACAGGGAANGTACACAAAGAAATCCTCTCTCAAAAAATNNNNN
NNNGATATTCACAGGTGTGGGGTGATACNAACCTCCATTCCCAGCACTCAGAANGNTAAAGAAACTATCCTGAGCTACAT
AGTGAATCTGANGNCNCCCTGGGCTACAAANTGAAACTTTGTCTNNAAAATAAACAANNNTGANCCNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10131G12BBR1
Sequence
GTGTCTTTGTGTACATATATGTATGTCTATGTGTGTCTTCTGTGTGTGTGTATGTGTGTGTCTTCTGTGTGTGTGTATGT
GTCTGTGTGTATATGTCTGTGTGAATTGATTTCTCACCATAACTCATTACAAATGAAAAAAACCTGAGAGGTTAACTAAC
TTTCCAGCACACAATTGAAACCTGCACCTGGATAGCTTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127342505..127342703 197
NO GENE  

 
Come back to gene ENSMUSG00000040127


For any suggestions or comments, please send an email to unitrap@crg.es