Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11373E9
Clone ID IST11373E9
Vector VICTR76
Project tigm

Sequence tag IST11373E9HMF1
Sequence
NCGTAACTTTTANCACTAATTGATTTTANACAAATCCCCCCCCTGGAGTTTGTGGGGGAGTACATTTGCTTCTTTATGTA
NCATGGGACTTGCTGTTTTCATTCACTGAAGTTTATTTATATAACAGATACTGTGGAAGGCACGCTGCATGCAGTAATAA
CTTGCTGTTGTTTTGAAAGGTTTCCTGTATCCCANGTTGAATTGAAACA
Sequence Type genomic DNA
Unitrap ID UNI15534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119612657..119612863 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]


Sequence tag IST11373E9BBF1
Sequence
GCGTAACTTTTANCACTAATTGATTTTANACAAATCCCCCCCCTGGNGTTTGTGGGGGAGTACATTTGCTTCTTTATGTA
NCATGGGACTTGCTGTTTTCATTCACTGAAGTTTATTTATATAACAGATACTGTGGAAGGCACGCTGCATGCAGTAATAA
CTTGCTGTTGTTTTGAAAGGTTTCCTGTATCCCAGGTTGAATTGAAACNCCTTATCTTCCTGCCTCCACTTCCCAAATGC
TGGGATTANTCTGTCTCNNCCTTGTGCATTTTACAGGCTTGAAACTTAATTTGGAATANCTTAAATAATTTGCCTAATTT
TACACTANTAAGTANTGGAGCTAGTATTTTATTTNTGACTTANGTTTCTAATGTTGCTGTTAAACAACCCGTCNCANNCC
CGTGTTTGTGTGTGTATTTACTGGGCAGTGAAACTACNGNNGTTCGGGAATCGTCTCACAAACACCAATCTNANNCAGGG
ATAGTTNANTGANCATATNTTNCATGNNTTGACNNAATTCNATGGTCCANNNTTGGGANCTGNNNCNTNNCCNNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es