Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14055H2
Clone ID IST14055H2
Vector VICTR74
Project tigm

Sequence tag IST14055H2BBF1
Sequence
ACAACAGGAATGGGCTGGAAAATAACAGAGGCTGGCAGCCCTTCCCTTCACTGTATGGGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126707039..126707105 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]


Sequence tag IST14055H2HMF1
Sequence
ACAACAGGAATGGGCTGGAAAATAACAGAGGCTGGCAGCCCTTCCCTTCACTGTATGGGAAGATCTGCATCTCAGCCACG
CCCTGGCTGTCTGAGACAATGGCTTCTCAGAGTGGCCTCTTTGGAAAGCCACCTCCCAAACTGAATGCCCTCTCGGGGCC
CACAGCCTGCCTTGGGTCCTAAAAGCACTCTGCTCATGGCTTAACCAGAGAAAATTAAGGACGCCTCAGAAGAACAGGAC
TCAGCTTCTCCCACCCTGTATGATATAGCCACTCCGAGGCCATGGAGAAGGAAGATTTCTGAGTCTACTTGGTGCCCTCT
CCCCACAACTGAGGCATGCCCTACCCCTGCCCAAAATTAGCCTTGTGTCTGAGGTTTGCTCTCACAGTTTGGAGTCACAG
AGGGGGCTGACTGTTCATTGACTGTTGCTGCAGTTTACTTACTGGAGTTTTTCCTAAN
Sequence Type genomic DNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126707039..126707495 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es