Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11893E3
Clone ID IST11893E3
Vector VICTR76
Project tigm

Sequence tag IST11893E3BBF1
Sequence
TTCNCAAAGAAATGAGGGTGGTTTTGTCTGGCTTATTGACAGTGTACTTGGACATTCTGGGCAGATGGAAAGGTTGCAAT
GATGGTCTANTTATNNATGANGCTGTGCTCCCATCTCCCATCNNTGTTCTGGGGATGCTGTCCANAGCTGGAAGTTAANT
GTGGTGTGANGGCANANTNTNCNNTGCNTGTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11893E3HMF1
Sequence
TTCACAAAGAAATGAGGGTGGTTTTGTCTGGCTTATTGACAGTGTACTTGGACATTCTGGGCAGATGGAAAGGTTGCAAT
GATGGTCTAGTTATAGATGAGGCTGTGCTCCCATCTCCCATCAGTGTTCTGGGGATGCTGTCCANAGCTGGAAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI22728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 18828034..18828192 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020160 (Meis1) NM_010789 Meis homeobox 1 Gene [Source:MGI (curated);Acc:Meis1-004]

 
Come back to gene ENSMUSG00000020160


For any suggestions or comments, please send an email to unitrap@crg.es