Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14669B11
Clone ID IST14669B11
Vector VICTR74
Project tigm

Sequence tag IST14669B11HMR1
Sequence
TCCGANTCCTCACTAAAATCCTGTGCTGAAGTTGTCCCTGGTGCGTGTCCGTTACATCGTCCCATTTCCNAACTCTGAGG
AAGACACACATGCTTCTTTCTCAGTGTTCAAGTCTGGACTTTTGATACTACTCTCAATGTACTGGCCTTCGGGAAATANT
GGAGAGGTTTAATTTTAATCTAAAGAAATTCTAACTCATATCCTGATATTTGTTAATCCNAAGCTTTTAATCCTTAATTT
CNTTTAAAAAAAAAANNNCN
Sequence Type genomic DNA
Unitrap ID UNI7193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30586691..30586945 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022538 (Lsg1) NM_178069 large subunit GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsg1-001]


Sequence tag IST14669B11HMF1
Sequence
CGGAATGTCCTCAAATACTCTGCTGGGATTAATTTCTATACTTCATTTACTTTTTAAGGCTACCACGATCTTCCCTAAGC
TTCTAGAGACAATGTCAATTTCTTACNATAAACCCCAAGGGGGCAAAACAAGGCAAAGCAGANATCGCCTCTAACGGANC
CATCTCTAGANGATCGATTCTCTGGGCAACTNAAATCGGAAAGTTTAAAAGATCCAAGCNTGGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30586942..30587170 217
 
EST/CDNA Est Name
  BY109485.1 - BY329046.1 - N28201.1

 
Come back to gene BY109485.1 - BY329046.1 - N28201.1


For any suggestions or comments, please send an email to unitrap@crg.es