Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-6G1
Clone ID FHCRC-GT-S21-6G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-6G1
Sequence
GAGATGGCAAGAATGAAGAGATTCTGAATTCCCTCAAGTACGTCCGACCTGGTGGCGGGTTCGAGCCCAATTTTACATTG
TTTGAGAAGTGCGAAGTGAATGGTGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAACACCCAGTGA
CGACCCCACTGCGCTCATGACCGACCCCAAGTACATCATTTGGTCTCCGGTGTGCCGCAACGACATTGCCTGGAACTTTG
AGAAGTTCCTGGTGGGCCCCGACGGTGTTCCCGTGCGCAGGTACAGCCGCCGCTTTCGTACCATCGACATCGAACCTGAC
ATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAAGGCGGCCCTGGCATTGGCTTGGTGATTACTGGCTGCACTCT
GGGGGGCGGTTCTTCCATGATGGTGTTTCCTCTAAATTTGCACGGAGAAACACCTGATTTCCAGGAAAATCCCCTCAGAT
GGGCGCTGGTCCCATCCATTCCCGATGCCTTTCCACCTAATGAAAGGTGGTTTCACTACTAAGAATAAAGTGCTGAATAT
CAGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI12653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108242112..108242673 562
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]

 
Come back to gene ENSMUSG00000063856


For any suggestions or comments, please send an email to unitrap@crg.es