Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-6F1
Clone ID FHCRC-GT-S21-6F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-6F1
Sequence
ATTTTATATTGGCTGTGATCGGTGTCAGAATTGGTACCACGGGCGCTGTGTTGGCATCTTGCAAAGTGAGGCAGATCTCA
TTGATGAGTATGTCTGTCCACAGTGCCAGTCGACAGAGGACGCCATGACAGTGCTCACACCACTGACAGAGAAAGATTAT
GAGGGCTTGAAGAGGGTGCTGCGCTCCTTACAGGCCCACAAGATGGCGTGGCCTTTCCTTGAACCGGTAGACCCCAATGA
TGCACCGGATTATTACGGTGTTATTAAAGAGCCAATGGACCTTGCCACCATGGAAGAAAGAATACAAAAACGGTATTATG
AAAAGCTGACAGAGTTCGTGGCAGATATGACCAAAATTTTTGATAACTGCCGTTATTACAATCCCCGTGACACCCCTTTT
TACCAGTGTGCAGAAGTTCTTGAATCATTCTTTGTACAGAAACTAAAAGGATTCAAGGCCAGCAGGTCTCATAACAACAA
GCTGCAATCTACAGCTCCTTAGAACTCAGCGTGTCTGTCACCTAAGCTAGACACAGCAAGTCTGGCGCTCTGAACTATTT
AAACTAAAGCGCCAGATATTTTCAGTCAGGCTTTCCTGACAAGACCGTAACCTCGTTCATATTGGTCACAACAGTCCAGT
TGTATTCTTGGCCAATTTTGTCCAACGGACAAAGGAAAAGCAAAGTCAACGGCACCGTTGTCTTGTCGAGAGCAAATGGC
TTT
Sequence Type genomic DNA
Unitrap ID UNI14259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106896896..106905139 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es