Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-4F1
Clone ID FHCRC-GT-S21-4F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-4F1
Sequence
GATTTGCAGTTCCTGACTACCGCTCTTCTCATATTGAAGTTAGCCAGGCATCACAGCTTTTACAGCAGCAGCAGCAGCAG
CAGCAGCTTCGAAGACGACCTTCCTTGCTTTCAGAATTTCACCCGGGTTCTGACAGGCCTCAAGAAAGGAGAACTGGATA
TGAACAGTTTCACTCAGGACCCTCACCGGTGGATCATGATTCCTTGGAGTCCAAGCGCCCACGCCTGGAGCCAGTTTCTG
ATGCCCATTTCCAGCGTGTTAGTGCTGCGGTTTTACCTTTAGTTCACTCGCTGCCAGAAGGCTTGAGGTCGTCTGCAGAT
GCTAAGAAGGATTCAGCATTTGGAAGCAAACATGAAGCTCCATCCTCTCCTTTGGCTGGGCAACCATGTGGAGATGACCA
AAATGCTTCACCTTCAAAGCTTTCAAAGGAGGAGTTAATACAGAGTATGGACCGGGTAGACCGAGAGATTGCAAAAGTAG
AGCAGCAGATCCTTAAATTGAAAAAGAAACAACAACAGCTAGAAGAAGAAGCAGCTAAGCCCCCTGAACCAGAGAAGCCT
GTGTCCCCTCCTCCTGTGGAACAAAAACACCGTAGTATTGTCCAAATTATTTATGATGAGAATCGGAAAAAAGCAGAAGA
AGCTCATAAAATATTTGAAGGTCTTGGCCCAAAAGTTGAACTGCCACTCTATAACCAGCCATCAGATACC
Sequence Type genomic DNA
Unitrap ID UNI14267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62217327..62247199 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es