Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-3D1
Clone ID FHCRC-GT-S21-3D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-3D1
Sequence
ATATCTCCCGGGGCCAATTCAGCACCTCTACCTGGCCATCCTAACAAGGTGATTTGTGAAAGGGTGAGACTTCAGAGCCT
GTTCCCTCTTCTCCCAAGTGATCAGAACACTACCATTCAAGAGGATGCTCACTTCAAAGCTTTCTTCCAGGTTCTTATAT
GTTTACCCTTTCCCTACACAGGGCTGAAAGTCACAGATACATTCTAGCTTGTTTCTAGGAAGGCTTAAACAAGCTTGTGA
GTATCCTCTTACTTTCTGTTGTATGTGGAAATTAGTACTCTTCTCAGAGACTTCTTGAAGGTAACTCTGAGCTTTTCTGA
AGAATCTTCTCTTGAGCTACTGTTCATTATTTTGCCACTTAATACTCTGTTTTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44171540..44171924 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035696 (Rnf38) NM_001038993 ring finger protein 38 Gene [Source:MGI (curated);Acc:Rnf38-017]

 
Come back to gene ENSMUSG00000035696


For any suggestions or comments, please send an email to unitrap@crg.es