Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-3C1
Clone ID FHCRC-GT-S21-3C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-3C1
Sequence
TCTTCCGTTTGTGCTAAGATCGTCCAGCTTTTGGGGCAGAATGAGGTGGATTACCACCAGAAGCAGGTGGTGATCCTGAG
CCAGGATAGCTTCTACCGAGTCCTCACCTCAGAGCAGAAGGCCAAAGCCCTCAAGGGCCAATTCAACTTTGATCACCCGG
ATGCCTTTGACAACGAACTCATCTTCAAAACACTCAAAGAAATCACCGAAGGAAAAACCGTCCAGATCCCCGTGTACGAC
TTTGTCTCCCACTCACGGAAAGAGGAGACGGTCACCATCTACCCCGCCGACGTGGTGCTCTTCGAAGGGATCCTAGCCTT
CTATTCCCAGGAGGTCCGAGACCTGTTCCAGATGAAGCTTTTTGTGGACACAGATGCGGATACCCGTCTGTCTCGCCGAG
TATTGAGGGACATCAGCGAAAGAGGGAGGGACCTTGAGCAGATTTTATCACAGTACATTACGTTTGTGAAGCCTGCCTTT
GAGGAATTCTGCTTGCCAACAAAGAAATACGCCGATGTGATCATTCCTAGAGGTGCCGACAATCTCGTGGCCATCAACCT
CATCGTGCAACACATCCAGGACATCCTCAACGGGGGGCTCTCCAAGCGGCAGACGAACGGCTATCTCAACGGCTACACCC
CTTCCCGCAAGAGGCAGGCGTCAGAGTCCAGCAGCCGACCACATTGACTCCCGTGCCCCTGACTCCAAACCCCAGCCCCC
CAGCTCC
Sequence Type genomic DNA
Unitrap ID UNI13682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169156473..169167779 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026558 (AC142244.11) NM_030724 Uridine-cytidine kinase 2 (UCK 2)(EC 2.7.1.48)(Uridine monophosphokinase 2)(Cytidine monophosphokinase 2) [Source:UniProtKB/Swiss-Prot;Acc:Q99PM9]

 
Come back to gene ENSMUSG00000026558


For any suggestions or comments, please send an email to unitrap@crg.es