Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-2E1
Clone ID FHCRC-GT-S21-2E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-2E1
Sequence
TTGAATGGATGCAGTCAGAACTAAATGTCGAAGAAGTGGTAAATGACAGGAGCTGGAAGGTGTTTAATGAACGCTGCCGA
GTTCACTTCAAGCCTCCAAAGAATGAGTAGAGAGAGAGTTTTTTTAAGACTCGGTCATCTCATCGCCTGGGCATGACAGA
TGTCAGCAGGGCCAGGTTCTGAGGGTGGTCTCTGAGCCAGCAGGCTGAGACCTTTGGTTGGTTCAGCCCCATTCAGCCAA
GACCTCAAGTCTAATTCTCATAATTATAAAATAATCAATTGCTATTTTATACTGATTCTGTAAAAAATGTTTTGTAACTA
TTAAAATAATTTTCTGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI10335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36089991..36092197 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es