Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12235C3
Clone ID IST12235C3
Vector VICTR76
Project tigm

Sequence tag IST12235C3HMF1
Sequence
TTCAGAGCACCTGCATTTGGAAGCCAGGGGCGGTTCGAACATGCGAGGAGCGGAAGGGCAAGGGCGGCCGCGTGGAGGCC
CGGCGGGCCGCGGGTCTAGGTGACCTTCCCGGCGGCGCCCTCTGGCTCTAGATCCCGTCGGTGTGGATCTGGTANAGACC
CTCCCACGGCCCAAGCCCTTCCCCACCAGCTCCAAGGGCCTGTGCAGACCCAGCTTCCTCCGCCGAGAGGACGAACTCCA
GGCACGGCCATGCCCTGGATCCCCCAGCCCCTACACGCCCTAGCCGGCCCACGCCCGGAGTAGGTGGCGCCGGGTCCCTC
CCGCGCATGCCAGTGTCTTCCCGGGCGGAACGGGCTGCCCTGAGTGGACTTAGGCCGCAGGAACAGGGACCTGGGCCTGG
ACTGAGAGCGAGACCCCATAGGGAGCCNTACGCTTGGCCTCCTTGGCCTCGGGGACGGANTCCGTGTTCTGTGTCGCCNA
ATGCNACTGTGCATTCTGGAAACTGNTTTNNNGNCCTGACATCAGANTGGAGGNCCGCAACTCTNCNNNGGTTTGTCCAA
GGTCNCACTGGN
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52174893..52175462 535
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]


Sequence tag IST12235C3BBF1
Sequence
TTCAGAGCACCTGCATTTGGAAGCCAGGGGCGGTTCGAACATGCGAGGAGCGGAAGGGCAAGGGCGGCCGCGTGGAGGCC
CGGCGGGCCGCGGGTCTAGGTGACCTTCCCGGCGGCGCCCTCTGGCTCTAGATCCCGTCGGTGTGGATCTGGTAGAGACC
CTCCCACGGCCCAAGCCCTTCCCCACCAGCTCCAAGGGCCTGTGCAGACCCAGCTTCCTCCGCCGAGAGGACGAACTCCA
GGCACGGCCATGCCCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52174893..52175153 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es